![]() Library PCR primer 2 (PN-220103): 5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGT -3' Library PCR primer 1 (PN-220111): 5'- AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTC -3' Truseq adapter (double stranded DNA with a T overhang, PN-220026):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACAC TCTTTCCCTACACGACGCTCTTCCGATCT -3' Reverse primer: 5'- AAGCAGTGGTATCAACGCAG -3' Poly-dT RT primer (PN-2000007): 5'- AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'ĬDNA Primer Mix (for cDNA amplification, PN-220106):įorward primer: 5'- CTACACGACGCTCTTCCGATCT -3' Conceptually, this kit is very similar to STRT-seq.īeads-TSO (PN-220112): |-5'- CTACACGACGCTCTTCCGATCT TTTCTTATATrGrGrG -3' The 5' Gene Expression kit is often coupled with profiling V(D)J from T/B cells (with TCR/BCR primers), but you can simply use this kit for gene expression purposes. Instead of using barcoded RT primers on the beads, the 5' Gene Expression kit use the same RT primer, but with barcoded Template Swithcing Oligos (TSO) on their gel beads. The 5' Gene Expression kit is similar to the 3' kit. Oligo sequence information is taken from The 10x Genomics Technical Note. ![]() The Chromium Single Cell 5’ Gene Expression is shown here. From translational immunology and immuno-oncology, to infectious disease research-these technological advancements, along with our intuitive software analysis and visualization tools, will accelerate the understanding of the adaptive immune system.10x Chromium 5' Gene Expression 10x Chromium 5' Gene Expression. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |