![]() Continued abuse of our services will cause your IP address to be blocked indefinitely. Please fill out the CAPTCHA below and then click the button to indicate that you agree to these terms. If you wish to be unblocked, you must agree that you will take immediate steps to rectify this issue. If you do not understand what is causing this behavior, please contact us here. How to make Sip of Magicka in ESO ESO Alchemy Recipe How To Make Drain Magicka ESO Crafting Writs: Craft a Sip of Magicka Online:Restore Magicka - The. If you promise to stop (by clicking the Agree button below), we'll unblock your connection for now, but we will immediately re-block it if we detect additional bad behavior. Overusing our search engine with a very large number of searches in a very short amount of time.Using a badly configured (or badly written) browser add-on for blocking content.Running a "scraper" or "downloader" program that either does not identify itself or uses fake headers to elude detection.Using a script or add-on that scans GameFAQs for box and screen images (such as an emulator front-end), while overloading our search engine.There is no official GameFAQs app, and we do not support nor have any contact with the makers of these unofficial apps. Continued use of these apps may cause your IP to be blocked indefinitely. This triggers our anti-spambot measures, which are designed to stop automated systems from flooding the site with traffic. Some unofficial phone apps appear to be using GameFAQs as a back-end, but they do not behave like a real web browser does.Using GameFAQs regularly with these browsers can cause temporary and even permanent IP blocks due to these additional requests. It can be used to add a Maximum Magicka Enchantment. If you are using the Brave browser, or have installed the Ghostery add-on, these programs send extra traffic to our servers for every page on the site that you browse, then send that data back to a third party, essentially spying on your browsing habits. Trifling Glyph of Magicka is an enchanting glyph in The Elder Scrolls Online.We strongly recommend you stop using this browser until this problem is corrected. The latest version of the Opera browser sends multiple invalid requests to our servers for every page you visit.The most common causes of this issue are: Rule violators will be warned and/or subsequently removed at the discretion of the moderation team.Your IP address has been temporarily blocked due to a large number of HTTP requests. Violation of the Rules is best addressed using the Report function. To mark something spoilers (for story or other relevant purposes), use the following format exactly as it appears: "(/spoiler)" Please participate in the subreddit before performing any promotion, self or otherwise.Though do keep a look out for our weekly threads We welcome questions about the game, including build questions.No posts which break the ZOS Terms of Service.Low-effort posts including memes will be removed. ![]()
0 Comments
![]() Library PCR primer 2 (PN-220103): 5'- CAAGCAGAAGACGGCATACGAGAT GTGACTGGAGTTCAGACGTGT -3' Library PCR primer 1 (PN-220111): 5'- AATGATACGGCGACCACCGAGATCTACAC TCTTTCCCTACACGACGCTC -3' Truseq adapter (double stranded DNA with a T overhang, PN-220026):ĥ'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' Illumina Truseq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3' Illumina Truseq Read 1 primer: 5'- ACAC TCTTTCCCTACACGACGCTCTTCCGATCT -3' Reverse primer: 5'- AAGCAGTGGTATCAACGCAG -3' Poly-dT RT primer (PN-2000007): 5'- AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN -3'ĬDNA Primer Mix (for cDNA amplification, PN-220106):įorward primer: 5'- CTACACGACGCTCTTCCGATCT -3' Conceptually, this kit is very similar to STRT-seq.īeads-TSO (PN-220112): |-5'- CTACACGACGCTCTTCCGATCT TTTCTTATATrGrGrG -3' The 5' Gene Expression kit is often coupled with profiling V(D)J from T/B cells (with TCR/BCR primers), but you can simply use this kit for gene expression purposes. Instead of using barcoded RT primers on the beads, the 5' Gene Expression kit use the same RT primer, but with barcoded Template Swithcing Oligos (TSO) on their gel beads. The 5' Gene Expression kit is similar to the 3' kit. Oligo sequence information is taken from The 10x Genomics Technical Note. ![]() The Chromium Single Cell 5’ Gene Expression is shown here. From translational immunology and immuno-oncology, to infectious disease research-these technological advancements, along with our intuitive software analysis and visualization tools, will accelerate the understanding of the adaptive immune system.10x Chromium 5' Gene Expression 10x Chromium 5' Gene Expression. ![]()
![]() Some quivers can hold as much as 30 while others can only hold about 2 or 3. Find out first how many arrows a specific case can hold before you actually purchase one. Evidently, you don’t need a big one if you do not have plenty of equipment to store. CapacityĪnother thing to ponder about when selecting a quiver is the size. It makes easy access & transport for the arrows, yet can be removed if the hunter uses a tree stand or hunting blind while hunting. This product attaches to the bow, yet can also be easily removed. ![]() The detachable bow quiver has become very popular with bowhunters. Hunters who use bows in open areas often prefer this type of quiver. They give shooters quick access to their arrows. They are usually made very quiet with special materials to keep the arrows from rattling. They’re not so popular with hunters though.Ī permanent solid mount bow quiver is attached to your bow about mid-way (to minimize the imbalance of the bow). I highly recommend the detachable ones because you can easily take away the weight from the bow before you shoot. Some bow quivers are attached permanently while others can be detached very easily. When you do this, you will be able to get that animal without a problem! You simply reach, grab it, set it, pull and release it when required. With a quiver, you won’t have that problem. When they get too excited and actually hit something, they forget where the arrows are and they eventually step on them and break them. This of course is a given, but you will be surprised at how many people take a lot of arrows with them to compensate for their aim that they lay them on the ground next to them. That is the most important part of hunting and without something to allow you to be fast on the draw, you will have a harder and longer time trying to kill that animal. This will allow you to have the upper hand on it all and be able to get the kill. When you have a quiver, you can easily reach behind you and pull out the arrow quickly. Any hesitation and you will lose the animal altogether. ![]() ![]() You need to be able to act fast and when you have your arrows in a quiver, you will be able to react fast and give it to them. When you are in the middle of the hunt, it is normal to become excited when you finally see your prey. When you are into hunting, and you choose to go on a hunting trip with your bow, you are going to have to be fast in the case that you miss your first shot. However, what they fail to notice is that a quiver is there to protect the arrows so that you can reuse them until they eventually cannot be used anymore. Many archers feel that having something on your shoulder, on your back, or mounted to your bow is somewhat restricting and impede your archery skills. Which quiver is best for target shooting?.Is there a difference between recurve and compound bow quivers?.Treelimb Quivers Premium Series 5-Arrow Compound Bow Quiver.Trophy Ridge Hex Light 2, Two-piece 5 Arrow Quiver.G4Free Archery Back Arrow Quiver with Molle System.Kratarc Archery Dual Use Leather Back Arrow Quiver Hip Quiver.Wyandotte Leather Large Center Back Quiver.Kratarc Multi-Function 4-Tubes Back Arrow Quiver.Sportsman’s Outdoor Products Tarantula T400 Quiver System.How to Find the Best Quiver for your needs?. ![]() Developers were building a subdivision near his property, so Leedskalnin bought 10 acres in nearby Homestead to get away. The gate broke again in 2005, and even with today’s technology, it has never quite worked as smoothly as it had when Leedskalnin built it.Įven more amazing is that Leedskalnin moved the whole kit and kaboodle-by himself-beginning in 1936. When the bearing began to rust and had to be replaced in 1986, it took a team of six men and a 50-ton crane to remove the stone. ![]() At one time the stone was so precisely balanced on an old truck bearing that it was said a child could spin the gate around with just a finger. The highlight of this spectacle, though, is a nine-ton, eight-foot tall revolving stone gate set between two segments of the wall with only a quarter inch of clearance on either side. In the garden, he built a variety of sculptures, including two 25-foot tall, 28-ton obelisks, and a massive 30-ton rock that has additional decorative stones on the top, eight feet off the ground. Leedskalnin lived on the second floor, which he furnished with hand carved stone tables, chairs, and a bathtub. In addition, the wall also contains a two-story tower built from blocks that average about nine tons each, for a total of 240 tons. No matter how he did it, though, it’s still a pretty amazing feat for a single man to build an eight-foot tall fence around 10 acres of land using stones four feet wide, three feet thick, and weighing more than 55 tons each. More rational minds think a tripod made of telephone poles and a block-and-tackle pulley system, that’s been seen in photographs, is the more likely method. Some neighborhood snoopers claim to have seen Leedskalnin lay his hands on a block of stone and chant a mysterious incantation, which caused the rock to float in the air. ![]() Just how he was able to do all of this work by himself using only basic hand tools is a bit of a mystery he intentionally worked late at night under the cover of darkness to hide his techniques. When he’d recovered, Leedskalnin used the skills he learned coming from a family of stonemasons to quarry, carve, and set huge slabs of oolite limestone-a form of sedimentary rock that often contains small pieces of fossilized shells and coral-all over his property. Heartbroken, Leedskalnin traveled to North America, spending time in Canada, California, and Texas before finally settling in Florida City, Florida in 1918 after coming down with tuberculosis. The Castle-which is located in Homestead, just outside of Miami-is the obsessive work of Edward Leedskalnin, a Latvian immigrant who spent nearly 30 years building this monument in stone for his “Sweet Sixteen” fiancée, a young woman who jilted him the night before their wedding day. Florida’s Coral Castle has been called the American Stonehenge, but a more apt comparison might be the Taj Mahal. ![]() At last, click OK to start converting OGG to MP3. When the Edit Metadata Tags window pops up, you can make some changes. If needed, you can change the audio quality and rename the file before saving it. Once the OGG file appears on the screen, navigate to File > Export, and select Export as MP3. Go to File > Open to import the OGG file you’d like to convert. Double-click the desktop icon to open the Audacity app. This audio application can be used as an excellent audio converter that enables you to convert OGG to MP3. AudacityĪudacity is a free, easy-to-use, multi-track audio editor and recorder, available for Windows, macOS, GNU/Linux, and other operating systems. Tap on the Start button to start the conversion. Then specify the destination file folder for this MP3 file. Open the drop-down list next to Profile and select MP3 as the output format. Then tap on the Convert/Save button at the bottom. Select the + Add… option to add the OGG file into the program after the Open Media window pops up. Go to the Media tab and select Convert/Save… More importantly, it can help you convert OGG to MP3 on almost all devices for free. VLC Media Player is a free, open-source, and cross-platform media player that plays most multimedia files, DVDs, audio CDs, VCDs, and various streaming protocols. Download videos, audio tracks, playlists as well as subtitles from YouTube.Ĭompatibility: Windows, Linux, Mac OS X, Unix, iOS, Android.Convert audio to video for sharing on social media platforms.Support 1000+ conversions between popular video and audio formats.100% free, no bundles, no ads, no watermarks.Then, you can check the converted files under the Converted tab. Click the Convert All button to convert all OGG files to MP3 format. Click the drop-down arrow next to Convert all files to. Then upload the folder containing multiple OGG files that you want to convert. Open the Add Files drop-down arrow to select Add Folder from the list. After conversion, navigate to the Converted tab and locate the converted MP3 file by clicking Show in folder. Tap on the Convert button to start the conversion. Do not forget to press OK to save your changes. ![]() Optionally, you can click the Edit icon behind Target to rename the output file and specify the destination folder. Besides, you can click the Edit icon to change parameters for the output MP3 file. Then select MP3 and choose an audio quality from the right side. Note: Please reinstall MiniTool Video Converter, if you cannot use the drag-and-drop method to import files when you use the software for the first time.Ĭlick the diagonal arrow under Target and go to the Audio tab to view all of the output audio formats. Alternatively, you can add the file by clicking the + icon or dragging. Under the Video Convert tab, click the Add Files button and then choose the OGG file that you want to convert and click Open. MiniTool Video Converter Click to Download 100%Clean & Safe ![]() How to convert OGG to MP3 with MiniTool Video Converter?įree to run this free audio converter on your computer and enter the main interface. Besides, it is also capable of downloading YouTube content. Therefore, it is an ideal choice for people who want to convert OGG to MP3 or MP3 to OGG for free. This free audio converter supports various audio formats, including MP3, WAV, M4A, WMA, AAC, AC3, AIFF, M4B, M4R, OGG, etc. which allows you to convert one audio format to another, audio to video, or even video to audio. The OGG converter is always available online and is completely free.Available on Windows, MiniTool Video Converter is 100% free and safe audio converter. You can convert your OGG documents from anywhere, from any machine or even from a mobile device. All documents are removed from the cloud after 24 hours. Expand the ConvertOptions and fill the fields for watermarking.Ĭonverted MP3 files are stored in the cloud. Or you can add a watermark to the converted MP3 file. Just expand LoadOptions and enter the password of your file. For example you can convert password protected documents. You even can perform more advanced conversions. Once conversion completed you can download your MP3 file. Just drag and drop your OGG file on upload form, choose the desired output format and click convert button. ![]() You can convert your OGG documents from any platform (Windows, Linux, macOS). ![]() Like the original X10 Mapple Pro, the E10 most closely resembles the Cessna 441 Conquest. Because of the higher range and capacity compared to the E-Claw, the Navigator. With the carbon fiber fully upgraded it can make a profit of 10k+ coins on a single flight from Tokyo to Honolulu in just 2 hours. The aircraft is probably the most efficient jet in the game due to its high capacity, low speed (compared to a Pearjet), and transatlantic capabilities. Like the other electric planes, it has half the range of the original Navigator, but 0 flight cost. The Aeroeagle is a medium-sized jet plane unlocked at level 16 that has 6 cargo/passenger slots. It has 2 slots, 1 for a passenger and 1 for cargo. Parts for it can only be obtained through Global Events, ads, lost & found, and trading. It is based on the real life Beechcraft B200 King Air. The Navigator-E is a special electric propeller plane based on the Navigator. While the range does make it harder to reach far-out event cities, the extra cities you pay for to reach them are usually far cheaper than the flight costs to deliver 500 jobs using regular Mapples. The Birchcraft is a small, twin turboprop aircraft that is unlocked at level 10. The E10 is widely considered to be the best electric plane, especially for delivering Global Event jobs. Unlocked at level 8, this Class 1 plane contains 3 cargo/passenger slots. ![]() Its name suggests being based on the real life Piper Navajo, to which it is strikingly similar in design. Like the other electric planes, it has half the range of the original Mapple, but 0 flight cost. The Mohawk is a small, twin engine propeller plane. It has 4 slots, 2 for a passengers and 2 for cargo. The E10 Mapple Pro is a special electric propeller plane based on the X10 Mapple Pro. ![]() You'll never believe what happened to me on my way into work today.I'd tell you this funny April Fools' Day joke about my pencil, but it's pointless.How come flowers don't like riding bicycles? They keep losing their petals.What did summer say to spring? Help, I'm about to fall!.Some bunny who? Some bunny's been pranking me all April Fools' Day. Knock, knock! Who's there? Some bunny.Why did the egg hide? It was a little chicken.What did one spring flower say to the other? You just gotta be-leaf in yourself!.You've heard that April showers bring May flowers, but do you know what May flowers bring? Pilgrims, mostly.Otto who? You otto know April Fools' is on April 1. What did the hammer say on April 1? April Tools' Day!.Anita who? Anita know when April Fools' Day is. What did one egg say to the other on April 1? Heard any good yolks today?.What did the lifeguard say on April 1? April Pools' Day!.I mean, they were literally born yesterday. Babies born on March 31 are so easy to prank on April Fools' Day. ![]()
![]() A light system that consists of two, three, or four boxes of lights that provide a visual indication of an aircraft’s position on the glidepath. If high more white lights will be visible. On glidepath when two white and two red lights are viewed. Most common type of VASI system Standard VASI system viewed from approach.Ģ0 Precision Approach Path Indicator (PAPI) If “Low on Glide Slope”, both appear red. If “High on Glide Slope”, both appear white. If on “Glide Slope”, first set of lights will appear white and second set red. Visual Approach Slope Indicator (VASI) The VASI is a system of lights on the side of an airport runway that provides visual descent guidance information during the approach to a runway View of VASI from approach.ġ9 Standard VASI system viewed from approach.Ĭonsist of two sets of lights Each set designed to appear either white or red depending on angle viewed. Used to guide pilots to lighted airports Green/White: Civilian Green/yellow: water airport Green/2 white: Military Green/yellow/white: Heliport Taxiway Lights Edge (Blue) TAXIWAY edges are indicated by Blue lights.ġ2 Airfield Lighting RUNWAY edges are indicated by White lights, followed by Amber and then Red as you move closer to the end of the runway. Threshold (green/red) In-pavement lights (17L-35R) Centerline Touchdown Zoneġ1 TAXIWAY edges are indicated by Blue lights. Arranged in two sets of four lights.ġ0 Runway Lighting Centerline Touchdown Zone Edge (white/amber) Supplement hold bars and hold position signage to alert pilots or vehicle operators of the holding position, especially during poor weather or periods of low visibility.ĩ Runway End Lights Used to depict the end of the useable runway to aircraft. Used to enhance the hold bar and elevated signs. Taxiway centerline and lead-on/off lights are green.Įlevated guard lights are used to identify the holding position for a runway especially at night and during periods of low visibility. Taxiway Centerline lighting is designed to facilitate ground movement, primarily during low visibility conditions. 2000’ of lights are alternating white/red and the last 1000’ are solid red. Runway centerline lights are white (clear). Runway Centerline lighting is used to provide pilots with alignment guidance during takeoff and landing operations, primarily during low visibility conditions. Clear (or white) except the last 2000’ of a precision or non-precision instrument runway, lights are amber.Ĥ Taxiway Edge Lighting Designed to identify the edge of the usable taxiway surface at night and during periods of low visibility. ![]() Single row of white lights bordering each side of runway and lights identifying the runway threshold Three Intensity Levels: High Intensity (HIRLs), Medium Intensity runway lights (MIRLs), and Low intensity runway lights (LIRLs) Some are Pilot Controlled, some ATC controlled Runway End Identifier Lights (REILS) High intensity white strobe lights placed on each side of the runway to mark the threshold Runway Lights White Taxiway Lights Blueģ Runway Edge Lighting Designed to identify the edge of the usable runway surface at night and during periods of low visibility. Runway Centerline Lighting Taxiway Centerline Lighting Elevated Guard Lights (Wigwags) In Pavement Guard Lights Runway End Lights Presentation on theme: "Airport Lighting Runway Lighting Taxiway Lighting"- Presentation transcript:ġ Airport Lighting Runway Lighting Taxiway Lighting We have a meeting point at the airport! you will find the information of it, in your reservation confirmation.įully privatized cancun airport can services without sharing options. ![]() We have friendly and professional staff at the airport, only to monitor your flight and welcome you, staff who kindly will guide you to your vehicle assigned for your private transfer. Transfers from airport Cancun to Cancun hotel zone, transfers to puerto juarez, transfers from airport Cancun to playa del Carmen, Riviera Maya transfers, playa mujeres and Tulum. Thanks to the flight monitoring app we will be able to know the precise time of your arrival in cancun.Ĭancun airport private Shuttle service, it has the guarantee of minimum waiting time. Private Tours : services to different archaeological sites such as : Chichen Itza, Coba, Tulum, Ek Balam, Xel Ha, Xcaret, Yal Ku, Ask for more sites!īy hiring private transfers at the airport of Cancun through us, not only get regular private Shuttle service, we have personalized assistance with our bilingual staff, who will also treat you with courtesy, the driver will take you confortably, and safe to your hotel destination. The round-trip transfer to the Embarcadero Isla Mujeres by Xcaret in Cancun is in luxury coaches, exclusively for our guests. Our representative will have a sign with your name written. These tours can be to archaeological ruins like the Chichen Itza Tour or the Tulum Private Tour, as well as water activities like the Cancun Snorkeling Tour of the Cenotes Tour.Īll the Transportations and Tours provided by Cancun Airport Transportation are private non-stop.We offer most competitive rates and offers for wonderful and beautiful places. Only 45 minutes from the Cancun International Airport 45 minutes from Tulum Experience round-trip airport transportation in luxury vehicles. If you are staying at Casa MayaKaan you can do several Cancun Tours with us. Included in Transportation from Cancun Airport to Casa MayaKaanĪll reservations of transportation services from Cancun Airport to Casa MayaKaan include bilingual operator, meet and greet at the airport and air-conditioned private unit. This time is estimated on regular weather and traffic conditions and may change according to this. The common duration of a transportation service to Casa MayaKaan departing from Cancun Airport is 3:00 Hrs. Approximate duration of the transfer from Cancun Airport to Casa MayaKaan ![]() ![]() Or because you could use some snacks, drinks and travel tips on the way there. Because you want to make sure to arrive comfortably and timely to Casa MayaKaan after a long flight. Given that Cancun Airport is located on the outskirts of Cancun and that no public transportation service has it on its route, there is the need for either a friend or family to pick up travelers, or for travelers to hire a taxi or private transportation service to arrive at their destination, typically a hotel or vacation rental. Why choose us for your transportation from Cancun Airport to Casa MayaKaan ?īecause you want to forget about the steering wheel, relax and let someone experienced do the drive for you. For groups up to 8, a regular van -our Private Transportation service, can make it for those wishing a more luxury experience, an elegant SUV -our Luxury Transportation services, could get the work done and for those traveling in groups from 9 to 16, a large van -our Group Transportation service, could be of help. That depends on the type of experience you wish to have and how many other passengers are traveling with you. Which transportation from Cancun airport to Casa MayaKaan suits me? On this page you can easily book your transportation to Casa MayaKaan in case you haven’t. Find upon the commonly asked by our clients traveling to Casa MayaKaan What is the best option for transportation from Cancun Airport to Casa MayaKaan ?Īccording to thousands of travelers, the most convenient way to reach Casa MayaKaan upon your arrival at Cancun Airport is by pre-booked private transportation. You may have questions about this service. You can request our services for the arrival to your hotel, and transfers from hotel to hotel, shopping tours around the city, open services for dinners, discos, etc. ![]() Casa Turquesa Boutique Hotel, Blvd Kukulcan KM 13.5, Zona Hotelera. After 6 years in the making they opened the doors in November 2012. Museo Maya de Cancun, It’s the largest structure built by the National Institute of Anthropology and History (INAH). FAQ about Transportation from Cancun Airport to Casa MayaKaan Amercian Shuttle Cancun is a company specializes in luxury private transportation, we offer private transport from Cancun International Airport to any destination in the Riviera Maya. (cancun airport transportation), (toll free: 557). Types of transportation services to Casa MayaKaanīy using any of our Private Transportation Services from Cancun Airport to Casa MayaKaan, you will reach your destination faster and easier. ![]() Beyond its complex design and the accurate shape of its fully-molded, lightweight and durable EPO airframe with a factory-applied finish, it also features an abundance of Extra Scale details including a variety of surface features, steps, antennas, wingtip "stinger" skids, and much more. Inspired by the incredible ingenuity and effort Mike Patey put into building the full-sized aircraft, E-flite® offers the only officially-licensed scale replica of the ultimate bush plane! The amazing DRACO 2.0m is one of the most highly-engineered, detailed and feature-rich RC models ever produced. Easy final assembly in less time than it takes to charge a battery.Factory-applied paint plus decal finish looks great and saves time.Durable, fully-molded EPO airframe with carbon fiber and wood reinforcement throughout.Two-piece wing with quarter-turn thumbscrews plus V2 hands-free servo connection system for quick and easy assembly/disassembly.Custom-made and fully-molded carbon fiber gear to handle short takeoffs from and landings on a variety of surfaces.Scale-like articulated and shock-absorbing main landing gear with oversized tundra-style tires.Shock-equipped and steerable tailwheel for improved forward and reverse ground handling.Large and convenient, magnetically-secured top hatch with large battery compartment.Six factory-installed metal-geared servos with internal, ball-link equipped linkages. ![]() The unmatched stability and locked-in feel of exclusive AS3X® technology.Easy to fly with innovative and optional-use SAFE® Select flight envelope protection.Optional-use motor reversing for special ground handling and other capabilities with compatible 7+ channel transmitters.100-amp Spektrum™ Avian™ Smart ESC provides real-time battery voltage, current draw, motor RPM, and other data via compatible receivers and transmitters.Fits batteries from 4000–7000mAh to provide a wide range of performance and flight times up to 10–15+ minutes.Factory-installed, high-power 4S- to 6S-compatible brushless motor with large diameter 4-blade prop.Clear windshield and windows plus a detailed cockpit with backlit instrument panel and pilot figure.One of the most highly-engineered, detailed and feature-rich E-flite® aircraft to date.The ultimate bush plane for an unmatched STOL, scale and beyond flying experience.The DRACO 2.0m is equally unique and astounding - and it's also one of the most highly-engineered, detailed and feature-rich E-flite® aircraft yet! Changes from the Wilga were so extensive that the FAA approved Mike's redesign as an experimental exhibition aircraft. It could go to the same places as a Carbon Cub, but also climb twice as fast reach altitudes up to 28,000 feet and cruise cross-country at 180 MPH while carrying four people plus gear. Many additional modifications followed before Mike proudly unveiled his "ultimate bush plane". Entrepreneur Mike Patey - whose exceptional drive and Back to Work™ ethic have inspired thousands of people - accomplished it in just over five months! Mike started with a Wilga 2000, replacing its Lycoming O-540 piston engine with a Pratt & Whitney PT6A-28 turboprop boasting about twice the power at half the weight. 4S 14.8V to 6S 22.2V 4000–7000mAh LiPo with EC5™ or IC5® Connectorīy most estimates, planning and building the full-size DRACO should have taken years. ![]()
|
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |